                                                                        Gene putatively regulated by attenuation in G_sulfurreducens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:129 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:96 nt. Size=41 nt.     Delta G=-11.13 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=47 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tagctt. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacttgtgggggattatcgtttagctttgtttacaccatagtctgctgggggagttcttgggaactgagacgggcaacgcccgaaccctttgaacctg
atccggtttataccggcgtagggaagcggccagaaacaatcatccgtacgtcttttctggaaccgcgactttgccgtcgcggtttttttttgaggagatt
tcctttcATG

   ف Gene: GSU0605     GI: 39995712     BI number: GSU0605     GOG: COG0351,COG0352     Description: thiamine-phosphate pyrophosphorylase/phosphomethylpyrimidine kinas ta t  t ta gc gc cg cg         c t  |      c  g a  |      t  t g  |      a  a t  |      c  c c  |      t  g c  |      a  t a  |      a  c a  |      c  t       tg gc        at       t  c tg        at       t  c t  t       at        cg ta        gc        at cg        at        gc cg        cg        cg cg        cg        gc |  a      |  a       cg a  a      |  a       cg a  g       gc        at gc        gc        at cg        cg        gt cg        gc        gt                         tttttgaggagatttcctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in G_sulfurreducens This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:85 nt.    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G= -9.77 kcal/mol Antiterminator:    Distance from promoter:50 nt. Size=49 nt.     Delta G=-12.20 kcal/mol Anti-antiterminator:    Distance from promoter:63 nt.    Size=18 nt.     Delta G= -4.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgact-tagctt. It has a score value of 72.96 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacttgtgggggattatcgtttagctttgtttacaccatagtctgctgggggagttcttgggaactgagacgggcaacgcccgaaccctttgaacctg atccggtttataccggcgtagggaagcggccagaaacaatcatccgtacgtcttttctggaaccgcgactttgccgtcgcggtttttttttgaggagatt tcctttcATG    ف Gene: GSU0605     GI: 39995712     BI number: GSU0605     GOG: COG0351,COG0352     Description: thiamine-phosphate pyrophosphorylase/phosphomethylpyrimidine kinas            ta           t  t            ta            gc            gc            cg            cg           t  |           a  |           g  |           t  |           c  |       ga           c  |      a  a           a  |      c  a           a  |      c  c            gc       g  a            tg       g  a           t  t      c  t            ta       g  c            cg       a  a            cg        at at        cg        gc g  c      a  a       gc t  c      a  a      g  g cg       g  |       at cg       c  |       ta at       c  |       gc at        cg        cg gt        gc        gt ta        cg        gc                         ttttctggaaccgcgactttgccgtcgcggtttttttttgaggagatttcctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................