                                                                        Gene putatively regulated by attenuation in H_ducreyi_35000HP

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:121 nt.    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=34 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:58 nt.    Size=51 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcat-tagaat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcattctatttcttgctggcttagaatacattgttctcattggggtgctgaaaataagctgagaaatacccatagaacctgatctgattcgtatcagc
gtagggatttgaggccatttctactacaactaggaattttaccgctcaaatccttctagtttatgttttgttagaaggactttttatATG

    tbpA --- HD0602 Gene: tbpA     GI: 33151789     BI number: HD0601     GOG: COG4143     Description: thiamine-binding periplasmic protein Gene: HD0602     GI: 33151790     BI number: HD0602     GOG: -------     Description: hypothetical protei gg a  c gc ta t  t t  t at gc gt |  a       cg gc       c  c at       a  t ta       t  c        g gc        ta       t  t c  a       ta       a  t g  a       ta       t  t a  c       at       t  t c  |      |  c      t  g t  |      |  c       gt at        at        at ta        gt        ta g  g       gc        cg cg        at        ta ta        ta        ta ta        cg        cg at        at        cg gt        at        ta                         ctttttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG4143 ABC-type thiamine transport system, periplasmic component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................