                                                                        Gene putatively regulated by attenuation in H_ducreyi_35000HP

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctattttaatcttcagggcagggtgaaattcccgatcggtggtaaagtccgcgagccgaacttcgattaacatcaagtttagcaggaactagtgaaattc
tagtaccgacagtatagtctggatggaagaagagcagaaataagaaaacccgtttcaagcggctgttttcgctattctttttgcataagccttgagatct
taggatttcaaggctttttcattagttaatttgcactatttaatgcaaattagtccgcttatagtgattccattcacttgcccgcttattattcattgat
ATG

    ribD --- ribE --- ribAB Gene: ribD     GI: 33152274     BI number: HD1161     GOG: COG0117,COG1985     Description: riboflavin-specific deaminase Gene: ribE     GI: 33152275     BI number: HD1162     GOG: COG0307     Description: riboflavin synthase, alpha chain Gene: ribAB     GI: 33152276     BI number: HD1163     GOG: COG0108,COG0807     Description: Riboflavin biosynthesis protein rib            ct           t  t           t  t   c       a  t t  a      t  t t  a       cg tg        gc gc       c  a cg       t  t cg       t  a |  c      t  | |  t      t  |       ta cg       g  |      t  g at        ta        cg at        cg        ta at        gc        at at        gc        gt gc       c  |       at |  g      g  |       gc a  c       at        ta at        at        ta ta        cg        cg at        ta        cg at        tg        gc                         tttttcattagttaatttgcactatttaatgcaaattagtccgcttatagtgattccattcacttgcccgcttattattcattgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................