                                                                        Gene putatively regulated by attenuation in H_influenzae

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTAGTGCCTAGGTATTTTGCGTTATACTTAGCTCGCATTCTCAGGGCAGGGTGAAA
TTCCCTACCGGTGGTAAAGCCCACgagcgtttaaaagtgcggtcaatttttggcaaatttttcctgcgaaattgtcctgatt
ttcacttttaaagtcagcagatttggtgaaattccaaagccgacagtaaagtctggatgaaagagaataaaacgagttgggttcccaaatcgtttatttt
atttgcatttctcagccctgattctggtatttaattgaaatctcaaattaggaaattactATG

    ribB --- HI0765 Gene: ribB     GI: 16272705     BI number: HI0764     GOG: COG0108     Description: 34-dihydroxy-2-butanone 4-phosphate synthase Gene: HI0765     GI: 30995400     BI number: HI0765     GOG: COG3306     Description: lipooligosaccharide biosynthesis protei   a a  a g  t t  t gc gc ta         g ta       t  a ta       a  a a  |      g  a g  |      g  g a  |       ta cg        cg gc        ta a  c      |  a cg       g  t ta       a  a gc       a  a a  a      a  a       tt a  g       ta       g  c at        gc        gc ta       |  g       gc ta       a  a       ta ta        cg        ta tg        at       g  a |  t       gt        at c  c       cg        gc at        cg        cg cg       g  g       at tg        at        at ta        at        at                         attttatttgcatttctcagccctgattctggtatttaattgaaatctcaaattaggaaattactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [M] COG3306 Glycosyltransferase involved in LPS biosynthesis ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................