Gene putatively regulated by attenuation in H_influenzae

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaaggtagctggagagcgggaaattgaccccacaccgacgatgtaaaatctttcaggtgcgatggcagggactgttactggacgaacccttggagagatc
cattttagaaatggacgccgaagcgcaaaagagcggttaatttttcaatcgtttttcaaacgctcaggcaaaaggacaggggcaaaagacaatctattgt
aagtgtggaaattatttatttttttaccgcactttcttttccattgtatcttttcgtcttcttgtcgtgtttattttgatttaaacgacgaggaatcaca
ATG

    HI0883


Gene: HI0883     GI: 16272823     BI number: HI0883     GOG: COG1115     Description: amino acid carrier protei



            t
          t  a
  a       t  t
c  a      a  t
a  t      t  t
 gc       t  t
 at        at
a  a       at
 at        at
 at       |  a
 cg        gc
 gt        gc
g  a       tg
g  a       gc
g  g       ta
 at        gc
 cg        at
 at        at
            tcttttccattgtatcttttcgtcttcttgtcgtgtttattttgatttaaacgacgaggaatcacaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1115 Na+/alanine symporter ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here
    ..................................................................................................................