                                                                        Gene putatively regulated by attenuation in H_influenzae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCTGGTTATAACATTATCGGTGATTTTAAAGCCTATAAATCAGGTCACGGTTTAA
ATAACAAGTTACTTCGTGCTGTTTTAGCAAATCAAGAAGCGTGGGAATTTGTAACCTT
TGAAGATAAAGCGCAAGTGCCACAAGGGTATGTAGCTCCAGTGCAAGTGCTTATTTAA
ttgttttattgttgaaaaagctatatttctggtgggaagtatagcttttttgtttcatctcgtgcttaaatagcgaatgtactaaaagtgcggtcaattt
cgtgggattttttataaggaagcattATG

    pheA Gene: pheA     GI: 16273071     BI number: HI1145     GOG: COG0077,COG1605     Description: chorismate mutase/prephenate dehydratas   G T  T A  A TG GC GT GC A  C A  A CG AT C  | CG                  gt GC         t       g  g TA       t  t       tg G  A      t  a       cg A  |      g  t       ta A  |      t  t       ta CG        tg        tg GT        At        at CG        At        ta GC        Tg        at A  |       Ta        ta AT        Ta        cg AT       A  a       gc TA        Ta        at AT        Ta        at GT        Cg        at AT        Gc        at                         ttgtttcatctcgtgcttaaatagcgaatgtactaaaagtgcggtcaatttcgtgggattttttataaggaagcattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................