                                                                        Gene putatively regulated by attenuation in H_pylori_26695

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.29 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAATTGAGCGAAACGATGCAAGCCCCCTAACTCCTCAACGACCTTTTCACCCGGCCT
TAAATACATGTGATAGGTGTTGGCTAAAATGAGTTTAGCGCCTAAAATTTCTTGCGCA
TCTGTAGCGTCTAAAGATTTGATGCAGCCTTGCGTGCCTACGGGCATAAAAACAGGCG
TTGCCACTTGAGAATGGGCTAAATTTAAAAGACCAGCTCGCGCGTTATTGTCAGTCGC
TTGGAGTTGAAAATCCATcgtttaagccttaatcttggatataatggcgtaatcattttttaggaagtTTG

    HP0282 --- HP0283 --- HP0284 --- HP0285 --- HP0286 --- HP0287 --- HP0288 --- HP0289 --- HP0290 --- HP0291 --- HP0292 --- HP0293 Gene: HP0282     GI: 15644910     BI number: HP0282     GOG: COG3400     Description: hypothetical protein Gene: HP0283     GI: 15644911     BI number: HP0283     GOG: COG0337     Description: 3-dehydroquinate synthase (aroB) Gene: HP0284     GI: 15644912     BI number: HP0284     GOG: COG0668     Description: conserved hypothetical integral membrane protein Gene: HP0285     GI: 15644913     BI number: HP0285     GOG: COG0621     Description: conserved hypothetical protein Gene: HP0286     GI: 15644914     BI number: HP0286     GOG: COG0465     Description: cell division protein (ftsH) Gene: HP0287     GI: 15644915     BI number: HP0287     GOG: NOG45922     Description: hypothetical protein Gene: HP0288     GI: 15644916     BI number: HP0288     GOG: NOG43452     Description: hypothetical protein Gene: HP0289     GI: 15644917     BI number: HP0289     GOG: COG5651     Description: toxin-like outer membrane protein Gene: HP0290     GI: 15644918     BI number: HP0290     GOG: COG0019     Description: diaminopimelate decarboxylase (dap decarboxylase) (lysA) Gene: HP0291     GI: 15644919     BI number: HP0291     GOG: COG1605     Description: hypothetical protein Gene: HP0292     GI: 15644920     BI number: HP0292     GOG: COG4866     Description: hypothetical protein Gene: HP0293     GI: 15644921     BI number: HP0293     GOG: COG0115,COG0147     Description: para-aminobenzoate synthetase (pabB TA T  A C  A C  T G  A G  C C  A       AA C  T      A  T CG       A  G AT        TA CG        CG TA       |  T T  T       GT T  |       GT TA        TA CG        TG CG        GC AT        TG G  |       GC CG        GC AT        AT AT        TA             AAATTTCTTGCGCATCTGTAGCGTCTAAAGATTTGATGCAGCCTTGCGTGCCTACGGGCATAAAAACAGGCGTTGCCACTTGAGAATGGGCTAAATTTAAAAGACCAGCTCGCGCGTTATTGTCAGTCGCTTGGAGTTGAAAATCCATcgtttaagccttaatcttggatataatggcgtaatcattttttaggaagtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3400 Uncharacterized protein conserved in bacteria ... can be seen here [E] COG0337 3-dehydroquinate synthetase ... can be seen here [M] COG0668 Small-conductance mechanosensitive channel ... can be seen here [J] COG0621 2-methylthioadenine synthetase ... can be seen here [O] COG0465 ATP-dependent Zn proteases ... can be seen here [N] COG5651 PPE-repeat proteins ... can be seen here [E] COG0019 Diaminopimelate decarboxylase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [S] COG4866 Uncharacterized conserved protein ... can be seen here [EH] COG0115 Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase ... can be seen here [EH] COG0147 Anthranilate/para-aminobenzoate synthases component I ... can be seen here     ..................................................................................................................