Gene putatively regulated by attenuation in L_johnsonii_NCC_533

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=44 nt.     Delta G= -3.51 kcal/mol
Anti-antiterminator:    Distance from promoter:41 nt.    Size=49 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtct-taagct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtcttttagtcttattaagcgtaagcttaaactgtaaatacatctggggtgcctatcgggctgagaatatacccattgaacctgtttgattaatatca
gcgtagggaaaatgactatttttagacttttatttaagtcacctctttaaggtggctttttatttttggaggaaaaaATG

    LJ0074 --- LJ0073 --- LJ0072


Gene: LJ0074     GI: 42518160     BI number: LJ0074     GOG: COG4721     Description: hypothetical protein
Gene: LJ0073     GI: 42518159     BI number: LJ0073     GOG: -------     Description: ABC transporter ATPase component
Gene: LJ0072     GI: 42518158     BI number: LJ0072     GOG: NOG43480     Description: ABC transporter permease componen


 aa
t  t
 ta         c
 at       a  t
 gc       g  t
 ta       a  t
|  g      t  t
t  c      t  a
t  g      t  t
 gt       t  t
 ta       t  t
 cg       a  a
 cg        ta
a  g       cg         t
a  a       at       t  t
g  a       gc       c  a
 ta        ta        ta
 ta       a  c       cg
 at       a  c       cg
 cg       a  |       at
c  a       at        cg
c  c       gc        tg
 at        gt        gc
 ta        gt        at
 at        at        at
                        tttatttttggaggaaaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4721 Predicted membrane protein ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here
    ..................................................................................................................