                                                                        Gene putatively regulated by attenuation in L_plantarum

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-14.73 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatagtagccggctggaagtgggtcaccacttatgaaggtcagtgaacggggcaaccgccgaaatcgatggatcagtgaccgattcatccgttgggcctt
ggttgaataaatcatggactgtcgcagctagaatagttgcggggcgctatcgacgatgaaatcagcaattatgtcaatcaatctgattaaagtctttttg
cgcacgttatcgtgaggcaaagaggctttttattttgattgtgctaacctgaatcggtgtgaacacttttagatataaatcgatttttggaggttctgca
ATG

    lysP Gene: lysP     GI: 28377818     BI number: lp_1008     GOG: COG0833     Description: lysine transport protei             t           g  c           t  a           a  a           t  t           t  c           a  a           a  a           c  t            gc            at            cg            ta            at            at   a       a  a g  a      g  a at       t  a ta       a  |       ta cg       g  |      t  t gt        cg        gc at        at        cg cg        gc        at gc       |  t       cg cg       c  t      |  a tg       t  t      g  g g  g      a  t       cg t  g      t  t       gc c  c       cg        ta a  g       gc        ta gc        cg        ta gt        gc        tg ta       g  a       ta at       g  |       cg |  c       gc        tg cg        cg        gc ta        gt        at                         ttttattttgattgtgctaacctgaatcggtgtgaacacttttagatataaatcgatttttggaggttctgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0833 Amino acid transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................