                                                                        Gene putatively regulated by attenuation in L_plantarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-23.10 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-22.42 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaatgagaatgttttaatataaataatcaatgaaacggaaaggatagatgattatgacgacgttagcattcaacgcaacttattattatggctttgctta
ttttaggtagcgcccgtgttggaaccttagatacggacggcacctacgttcgtgtctaagcgaagtcaattcatcttggccagctagacaccgtgagtct
agctggaataatatcatcaattaggattgaattttgatgagccggctagattttcacaatctagccggctttttttatttccacgaaggagttgttattc
ATG

    lp_2038 --- aroF --- lp_2036 --- aroE --- tyrA --- aroI Gene: lp_2038     GI: 28378671     BI number: lp_2038     GOG: COG0477     Description: transport protein Gene: aroF     GI: 28378670     BI number: lp_2037     GOG: COG0082     Description: chorismate synthase Gene: lp_2036     GI: 28378669     BI number: lp_2036     GOG: -------     Description: unknown Gene: aroE     GI: 28378668     BI number: lp_2035     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferase Gene: tyrA     GI: 28378667     BI number: lp_2034     GOG: COG0287     Description: prephenate dehydrogenase Gene: aroI     GI: 28378666     BI number: lp_2033     GOG: COG0703     Description: shikimate kinas             t           a  t           g  g           g  a           a  a           t  t           t  t            at            at            cg            ta            at            cg            ta           a  g           t  |           a  |        c           a  |      t  a           t  |      t  c   g       a  |       ta c  t      a  |       ta c  g       gc        at a  a       gc        gc cg        tg        at at        cg        ta gc        gc        cg at        at        gc ta        ta        gc cg        cg        cg gc        ta        cg at        gt        gc cg        at        at cg        gt        gt                         tttttatttccacgaaggagttgttattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [E] COG0082 Chorismate synthase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0703 Shikimate kinase ... can be seen here     ..................................................................................................................