                                                                        Gene putatively regulated by attenuation in L_lactis

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aataaatcttcagggcagggtgtaattccctaccggcggtatagcccgcgagctgcttgcagcatgattcggtgaaactccgaggccgacagtatagtct
ggatgaaagaagataataaaaccataatactctagtcagtattatgtctatttagcctaaaactctggagtgaattgatacaattcactccatttttggt
tttttgagctgcttttttgctcaaaaaaaaatagaaaatttatcaaaagaccctgaaattttattttagggtcttattttttattagaaaggatgaatag
ATG

    ribG --- ribB --- ribA --- ribH Gene: ribG     GI: 15672975     BI number: L0163     GOG: COG0117,COG1985     Description: riboflavin-specific deaminase Gene: ribB     GI: 15672976     BI number: L0164     GOG: COG0307     Description: ribiflavin synthase alpha chain Gene: ribA     GI: 15672977     BI number: L0165     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II Gene: ribH     GI: 15672978     BI number: L0166     GOG: COG0054     Description: ribiflavin synthase beta chai tc c  a g  a ta ta ta ta ta ta c  a gt ta cg |  a |  a |  a |  a |  t |  t |  t g  a at gc ta         t ta       t  t ta        ta ta        at tg        at ta        at gc        gt gc        ta |  c       cg t  t       cg tg        cg ta        at ta        gc ta        at at        at             attttttattagaaaggatgaatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in L_lactis This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.40 kcal/mol Antiterminator: Size=36 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=65 nt.     Delta G=-10.09 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aataaatcttcagggcagggtgtaattccctaccggcggtatagcccgcgagctgcttgcagcatgattcggtgaaactccgaggccgacagtatagtct ggatgaaagaagataataaaaccataatactctagtcagtattatgtctatttagcctaaaactctggagtgaattgatacaattcactccatttttggt tttttgagctgcttttttgctcaaaaaaaaatagaaaatttatcaaaagaccctgaaattttattttagggtcttattttttattagaaaggatgaatag ATG     ribG --- ribB --- ribA --- ribH Gene: ribG     GI: 15672975     BI number: L0163     GOG: COG0117,COG1985     Description: riboflavin-specific deaminase Gene: ribB     GI: 15672976     BI number: L0164     GOG: COG0307     Description: ribiflavin synthase alpha chain Gene: ribA     GI: 15672977     BI number: L0165     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II Gene: ribH     GI: 15672978     BI number: L0166     GOG: COG0054     Description: ribiflavin synthase beta chai ag t  t c  c ta cg at ta at at ta at cg c  | a  | a  | a  | a  | t  | a  | a  | t  | a  | g  |        a a  |      a  c a  |      a  t g  |      a  c a  |      t  t a  |       cg         t at        cg       a  a gc       |  a       gc |  t      g  g       ta ta        at        ta at        tg        at gt        ta        at gt        ta        gc ta        at        ta cg       t  t       gc t  c       cg        at gc        ta        gc at        gt        gc ta        ta        ta                         tttttggttttttgagctgcttttttgctcaaaaaaaaatagaaaatttatcaaaagaccctgaaattttattttagggtcttattttttattagaaaggatgaatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in L_lactis This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.40 kcal/mol Antiterminator: Size=36 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=24 nt.     Delta G= -6.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aataaatcttcagggcagggtgtaattccctaccggcggtatagcccgcgagctgcttgcagcatgattcggtgaaactccgaggccgacagtatagtct ggatgaaagaagataataaaaccataatactctagtcagtattatgtctatttagcctaaaactctggagtgaattgatacaattcactccatttttggt tttttgagctgcttttttgctcaaaaaaaaatagaaaatttatcaaaagaccctgaaattttattttagggtcttattttttattagaaaggatgaatag ATG     ribG --- ribB --- ribA --- ribH Gene: ribG     GI: 15672975     BI number: L0163     GOG: COG0117,COG1985     Description: riboflavin-specific deaminase Gene: ribB     GI: 15672976     BI number: L0164     GOG: COG0307     Description: ribiflavin synthase alpha chain Gene: ribA     GI: 15672977     BI number: L0165     GOG: COG0108,COG0807     Description: GTP cyclohydrolase II Gene: ribH     GI: 15672978     BI number: L0166     GOG: COG0054     Description: ribiflavin synthase beta chai             t           c  a           t  t           g  t           t  t            aa         t            tg       a  a ag       |  c       gc t  t      t  c       ta c  c       at        ta ta        ta        at cg        ga        at at        aa        gc ta        ca        ta at       t  c       gc at        gt        at ta        ac        gc at        tt        gc cg        cg        ta                         tttttggttttttgagctgcttttttgctcaaaaaaaaatagaaaatttatcaaaagaccctgaaattttattttagggtcttattttttattagaaaggatgaatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0117 Pyrimidine deaminase ... can be seen here [H] COG1985 Pyrimidine reductase, riboflavin biosynthesis ... can be seen here [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here [H] COG0807 GTP cyclohydrolase II ... can be seen here [H] COG0054 Riboflavin synthase beta-chain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................