                                                                        Gene putatively regulated by attenuation in L_lactis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAATGACCGCTCAGTTATTTTTACTATTTCCTTAGCAACAATTGCAATCCTTGCAA
TTATTTACTACCTCATCTATAAGGCAACGAGTCGTGTTTACTACAAAATTGTTGAAAG
ATAAaaaagaaggcataaatatgcctctttttttgtttaaatccatatagaagaaacaagggaaggaaaaagctacaaaagagagctacttttgata
taataaaaggaacaaaaacaatggttttctcggcactaaatgtatcttttgttagagaaaaatagttacctttagggaaaggaaaatATG

    ysaA --- llrG --- kinG --- tyrA Gene: ysaA     GI: 15673730     BI number: L188881     GOG: COG4767     Description: hypothetical protein Gene: llrG     GI: 15673729     BI number: L0133     GOG: COG0745     Description: two-component system regulator Gene: kinG     GI: 15673728     BI number: L0132     GOG: COG0642     Description: sensor protein kinase Gene: tyrA     GI: 15673727     BI number: L0058     GOG: COG0287     Description: prephenate dehydrogenas            AA           G  A            TG            TA            GT            TA   A        TA T  C      A  a       aa T  T      A  a      a  t TA       A  a       ta GC       A  |       at TA       C  |       cg G  A      A  |       gc C  A       Ta        gc T  A       Cg       a  | G  |      A  a       at AT        Ta        gc GT        Tg        at CG        Tg        at AT        Gc        at AT        Ta        at CG        Gt        At                         ttgtttaaatccatatagaagaaacaagggaaggaaaaagctacaaaagagagctacttttgatataataaaaggaacaaaaacaatggttttctcggcactaaatgtatcttttgttagagaaaaatagttacctttagggaaaggaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG4767 Glycopeptide antibiotics resistance protein ... can be seen here [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here     ..................................................................................................................