                                                                        Gene putatively regulated by attenuation in L_lactis

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.70 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=37 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:    Distance from promoter:92 nt.    Size=47 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tataat. It has a score value of 91.03 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataagcaaactatttttgtgctataataaaaatatcttcagggcaccgtgtaattcgggaccggcggtaaatagggctttgaccttatgactccgcg
attcgctacggcgattgaagcagtgagaatctgctagcgacagtaaagtctggatggaagaagatgaacaatttttgtagtgtaatcaacttcggttgga
ttactgtttttagccaaaccaaaaatgtctatcaacttcctcgaaatttgaagaattattttctcatatttggaggtttttttATG

    ynaE Gene: ynaE     GI: 30024032     BI number: L106755     GOG: COG3601     Description: hypothetical protei aa a  g t  t gc at cg a  g g  a c  |       tt g  |      t  t at        tg tg        at cg       a  a       tc |  a       cg       t  g |  a       at        cg |  g      |  g       at g  a      a  t       at ta       g  a       cg cg        ta        tg ta        at       a  a at        gc       a  t a  g      a  a      t  | g  a      a  a       gt a  |       gc        ta g  |       at        gc ta        at        at gc        gc        tg                         tttttagccaaaccaaaaatgtctatcaacttcctcgaaatttgaagaattattttctcatatttggaggtttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................