Gene putatively regulated by attenuation in L_innocua

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -4.62 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctcatccaaatggtgaggtagaggttgcgagatgcactagtaattttttcgaggcgaaacaaagacgccaatgacaaaaaacgaacaggttaatcgccg
aagtgactattttttctttgtatcgaaatagttgttgggacagtttcctaaaggagctggactgctataagaatttgtcgaaatttcttataggtgtgct
atctgacaaaatgatgttggtaaaatacgtaacagccaatttcttgcagattggctgtttttttgcgcacttcctctgataaaagaaagggagatttata
GTG

    lin0791


Gene: lin0791     GI: 16799865     BI number: lin0791     GOG: COG0833     Description:


  c
a  g        t
t  t      t  g
a  a      c  c
a  a       ta
a  c       tg
a  a       ta
 tg        at
 gc        at
 gc        cg
 ta        cg
 ta        gc
 gt        at
t  t       cg
 at        at
 gc        at
            tttttgcgcacttcctctgataaaagaaagggagatttataGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0833 Amino acid transporters ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here
    ..................................................................................................................