                                                                        Gene putatively regulated by attenuation in L_innocua

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -9.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGATAGTCCTGAAAGTGCTAAGCGGGAAATTCAGTTATTTTTTGAACCACATGAA
ATTTTAAGTTATGAAAAGGCAGTAGATACTTGGATTTAAaataagtaagagtttagggaaacctaggctct
tttttcatagagaaaataccatttggcgcggttttttgttatgatgaaagaatgagactaaagtattgtgttctcgcttggcatatgttaagatattaca
catatactttaaagcgctaaaatatcattgctagaatatctagcttaaatagaaaaaggagagttgttgaaATG

    aroF --- aroB --- lin2040 --- hisC --- tyrA --- aroE Gene: aroF     GI: 16801108     BI number: lin2042     GOG: COG0082     Description: - Gene: aroB     GI: 16801107     BI number: lin2041     GOG: COG0337     Description: - Gene: lin2040     GI: 16801106     BI number: lin2040     GOG: COG4401     Description: - Gene: hisC     GI: 16801105     BI number: lin2039     GOG: COG0079     Description: - Gene: tyrA     GI: 16801104     BI number: lin2038     GOG: COG0287     Description: - Gene: aroE     GI: 16801103     BI number: lin2037     GOG: COG0128     Description: TA G  G A  A C  T G  A GC AT AT A  G A  | G  | T  | A  | TG TA GT AT AT TA TA Ta Ta At A  a A  a G  g T  t A  a C  a A  g       aa C  a      g  a Cg        gc At        gc At        at Gt        ta Ta        tg Tg        tg Tg        gc Tg        at Ta        gc Ta        at             tttttcatagagaaaataccatttggcgcggttttttgttatgatgaaagaatgagactaaagtattgtgttctcgcttggcatatgttaagatattacacatatactttaaagcgctaaaatatcattgctagaatatctagcttaaatagaaaaaggagagttgttgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0082 Chorismate synthase ... can be seen here [E] COG0337 3-dehydroquinate synthetase ... can be seen here [E] COG4401 Chorismate mutase ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................