                                                                        Gene putatively regulated by attenuation in L_innocua

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcagggtgcaattcccgaccggtggttaaagtccacgatctgctttcttagcagttgactctggtgtaattccaggaccgacagtatagtctggatggg
agaagatgttggcagaccttttcgtttgtcttcacgagcatgtgttagcaagctgtgatgcttatttgagtattcagtgcttgtttaattaatcacaaac
tctccctcgactttttttagttgaggttttttatttgcttgggttgcattcgtttagtgatgtcactcgcttcttggtgaacatcaagggagaaatgaca
ATG

    lin2059 Gene: lin2059     GI: 16801125     BI number: lin2059     GOG: COG3601     Description:            tt           g  a            tg            gc            ta        tt           a  a      a  t            cg        tg            gc        ta tt        at        cg t  t      g  |       gt c  c       cg        ta cg        at        at at        cg        gt gt        ta       t  | at       t  t       gc cg       c  |       ta gt        tg        cg gc        gc        gt t  t      t  t      a  | t  t      t  t      a  | gc        ta        cg ta        gt        gc                         ttgtttaattaatcacaaactctccctcgactttttttagttgaggttttttatttgcttgggttgcattcgtttagtgatgtcactcgcttcttggtgaacatcaagggagaaatgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................