                                                                        Gene putatively regulated by attenuation in L_monocytogenes

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=66 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGGATAGCCCAGAAAGTGCGCAGCGGGAAATTCAGTTGTTTTTTGCACCGGACGAA
ATTTTAAGCTATCAAAAAGCAGTCGACACTTGGATTTAGcatagtatagagtttagggaaacctaggctct
tttttcatagagaaattaccatttaatgccgttttttggtaagatgaaagaatgaaacgaaagtattgtgttctagcttctcatatgttaagatattaca
catatactttaaagcgctaaaatataaacgctagaaaatctagctgaaatagaaaaaggagagatgagcagATG

    aroF --- aroB --- lmo1926 --- hisC --- tyrA --- aroE Gene: aroF     GI: 16803967     BI number: lmo1928     GOG: COG0082     Description: - Gene: aroB     GI: 16803966     BI number: lmo1927     GOG: COG0337     Description: - Gene: lmo1926     GI: 16803965     BI number: lmo1926     GOG: COG4401     Description: - Gene: hisC     GI: 16803964     BI number: lmo1925     GOG: COG0079     Description: - Gene: tyrA     GI: 16803963     BI number: lmo1924     GOG: COG0287     Description: - Gene: aroE     GI: 16803962     BI number: lmo1923     GOG: COG0128     Description:            AC           C  T           A  T           G  G            CG            TA            GT            AT           |  T           |  A            CG            Gc           A  |   A       A  | A  T      A  | A  T      A  | G  T      A  | C  T      C  | A  A       Ta G  A       At G  G       Ta C  C       Cg C  T       Gt A  A      A  a C  T       At GC        Ta TA        Tg TA        Ta        aa TA        Tg       g  a TA        At        gc TA        At        gc TG        At        at GC       G  a       ta TA       C  |       tg TG       A  |       tg G  T      G  |       gc A  C      G  |       at CG        Cg        gc TA        Cg        at                         tttttcatagagaaattaccatttaatgccgttttttggtaagatgaaagaatgaaacgaaagtattgtgttctagcttctcatatgttaagatattacacatatactttaaagcgctaaaatataaacgctagaaaatctagctgaaatagaaaaaggagagatgagcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0082 Chorismate synthase ... can be seen here [E] COG0337 3-dehydroquinate synthetase ... can be seen here [E] COG4401 Chorismate mutase ... can be seen here [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here [E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here     ..................................................................................................................