                                                                        Gene putatively regulated by attenuation in L_monocytogenes

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcagggtgcaattcccgaccggtggttaaagtccacgatctgcttttttagcagttgactctggtgtaattccaggaccgacagtatagtctggatggg
agaagatgttggcagaccttttcgtttgtcttcacgagcatgtgttggcaagttgtgatgcttatttgagtatctagcgcttgtttattaatgcacaaac
tctccctcaactttttttagttgaggttttttatttgcttgggttgcattcgttaagcgacgtcactcgcttcttggtgaacatcaagggagaaatgaca
ATG

    lmo1945 Gene: lmo1945     GI: 16803984     BI number: lmo1945     GOG: COG3601     Description:            tt           g  g            tg            gc            ta        tt           a  a      a  t            cg        tg            gt        ta tt        at        cg t  t      g  |       gt c  c       cg        ta cg        at        at at        cg        gc gt        ta       |  t at       t  t      t  a cg       c  |      g  g gt        tg       t  c gc        gc        tg t  t      t  t       gc t  t      t  t       at gc        ta        at ta        gt        cg                         tttattaatgcacaaactctccctcaactttttttagttgaggttttttatttgcttgggttgcattcgttaagcgacgtcactcgcttcttggtgaacatcaagggagaaatgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................