Gene putatively regulated by attenuation in L_monocytogenes_4b_F2365

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=31 nt.     Delta G= -4.62 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggga-tggact. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgggacagtttcctaaaggggctggactgctataagaatttgtcgaaatttcttataggtgtgctatctgacaaaatgatgttggtaaaatacgtaaca
gccaatttcttgcagattggctgtttttgcgcacttcctctgataatagaaagggagattaataGTG

    LMOf2365_0815


Gene: LMOf2365_0815     GI: 46907029     BI number: LMOf2365_0815     GOG: COG0833     Description: lysine-specific permeas


  c
a  g
t  t
a  a        t
a  a      t  g
a  c      c  c
a  a       ta
 tg        tg
 gc        ta
 gc        at
 ta        at
 ta        cg
 gt        cg
t  t       gc
 at        at
 gc        cg
            tttttgcgcacttcctctgataatagaaagggagattaataGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0833 Amino acid transporters ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Lysine_riboswitch sequence ... can be seen here
    ..................................................................................................................