Gene putatively regulated by attenuation in L_monocytogenes_4b_F2365

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:154 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.50 kcal/mol
Antiterminator:    Distance from promoter:128 nt. Size=30 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:    Distance from promoter:90 nt.    Size=50 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgccg-taagct. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgccgaacaatacaactcatgataagctatagaaaaggcaaatacataatagaattagcgggtgaatgtaagcagagagactgcgaaaagcggcgccga
cggggaaagcatgtattatgtgaaactctcaggcaaaaggatgtttacgggacgcaactctggagtcatttttgtgttacgacagggcttatgaaccata
taagcctttttgttatgtgaaaaaggaggatataattATG

    gcvT --- gcvP1 --- gcvP2


Gene: gcvT     GI: 46907574     BI number: LMOf2365_1365     GOG: COG0404     Description: glycine cleavage system T protein
Gene: gcvP1     GI: 46907575     BI number: LMOf2365_1366     GOG: COG0403     Description: glycine cleavage system P protein, subunit 1
Gene: gcvP2     GI: 46907576     BI number: LMOf2365_1367     GOG: COG1003,COG0403     Description: glycine cleavage system P protein, subunit


  c
a  g
t  g
 tg
 ta
 gc
 tg
|  c
a  a
g  a
 gc
 at
a  |
a  |
a  |       tt
c  |      t  t
g  |       tg
 gc        at         c
 at        cg       a  c
 cg       |  t      a  a
t  |      |  t       gt
 cg        ta        ta
 ta        gc        at
 cg       a  g       ta
a  |      g  a       ta
a  |       gc        cg
 at        ta        gc
 gc        cg        gc
 ta        tg        gt
 gt        cg        at
                        tttgttatgtgaaaaaggaggatataattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here
[E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here
[E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here
[E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here

    ..................................................................................................................