                                                                        Gene putatively regulated by attenuation in L_monocytogenes_4b_F2365

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:135 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.10 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=56 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-tataat. It has a score value of 86.35 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaccctgctcctttagaaagctataataaacaacataacttaaaaccgaaatacttatataatagttgcgattgggcgacgagtttctacctggttac
cgtaaataaccggactatgagtagtttgtataaagaagtcactccgaaaattggtggcttctatactgcttctctatttttagagaagcagtttttttat
tttgaaaggagaatcgttTTG

    pbuX --- LMOf2365_1912 Gene: xpt     GI: 46908117     BI number: LMOf2365_1914     GOG: -------     Description: xanthine phosphoribosyltransferase Gene: pbuX     GI: 46908116     BI number: LMOf2365_1913     GOG: COG2233     Description: xanthine permeas   a a  a g  a c  t c  t tg cg at cg tg gc at at gc at a  | a  |       tt ta       t  t at        at ta        ta gc        cg t  t       ta t  |       cg tg        ta gc        ta at        cg t  t       gc gc        ta at        cg gc        at             ttttttattttgaaaggagaatcgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG2233 Xanthine/uracil permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in L_monocytogenes_4b_F2365 This operon is putativelly rgulated by Guanine_G-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:137 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.80 kcal/mol Antiterminator:    Distance from promoter:101 nt. Size=56 nt.     Delta G=-18.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgacc-tataat. It has a score value of 86.35 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgaccctgctcctttagaaagctataataaacaacataacttaaaaccgaaatacttatataatagttgcgattgggcgacgagtttctacctggttac cgtaaataaccggactatgagtagtttgtataaagaagtcactccgaaaattggtggcttctatactgcttctctatttttagagaagcagtttttttat tttgaaaggagaatcgttTTG     pbuX --- LMOf2365_1912 Gene: xpt     GI: 46908117     BI number: LMOf2365_1914     GOG: -------     Description: xanthine phosphoribosyltransferase Gene: pbuX     GI: 46908116     BI number: LMOf2365_1913     GOG: COG2233     Description: xanthine permeas   t t  c c  t g  a g  t ta gc gt tg tc at at ac at gc c  | c  | tt ca        tt at       t  t ct        at t  t       ta g  |       cg at        ta a        cg g        ta a         ta a        cg a        gc t        ta             gtttttttattttgaaaggagaatcgttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG2233 Xanthine/uracil permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................