                                                                        Gene putatively regulated by attenuation in L_monocytogenes_4b_F2365

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcagggtgcaattcccgaccggtggttaaagtccacgatctgcttttttagcagttgactctggtgtaattccaggaccgacagtatagtctggatggg
agaagatgttggcagaccttttcgtttgtcttcacgagcatgtgttagcaagctgtgatgcttatttgagtatccggttcttgtttattcattcacaaac
tctccctcaactcttttcagttgaggttttttatttgcttgggttgcattcgtctagtgatgtcactcgcttcttggtgaacatcaagggagaaatgaca
ATG

    LMOf2365_1975 Gene: LMOf2365_1975     GI: 46908179     BI number: LMOf2365_1975     GOG: COG3601     Description: membrane protein, putativ            tt           g  a            tg            gc            ta           a  a            cg            gc        tt tt        at       a  t t  t      g  |       tg c  c       cg        ta cg        at        cg at        cg        gt gt        ta        ta at       t  t       at cg       c  |       gc gt        tg       t  | gc        gc        gc t  t      t  t       tg t  t      t  t       cg gc        ta        gt ta        gt        at                         cttgtttattcattcacaaactctccctcaactcttttcagttgaggttttttatttgcttgggttgcattcgtctagtgatgtcactcgcttcttggtgaacatcaagggagaaatgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................