                                                                        Gene putatively regulated by attenuation in M_loti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.67 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAAGCGCGGCCTGAttgcggcgcaagcaacggcgccgcccggcccttgtcttgactcttcggtcgatttcctgtctacacgcctcg
aattccgcgacgagtatccctccgagcaagccgaccaggacgccgaagcctctttgaggccaagtgctgtaaacagatcctggaggccaacacccggcag
cgcaatgcgcccccgggtgctttttggttttgggctttgcttttgcttggacagttggcgcgaacgcattacctctcgggcatcatccgggtgccaggga
aaaggaaaacgaATG

    mlr4379 --- mlr4380 --- mlr4381 Gene: mlr4379     GI: 13473694     BI number: mlr4379     GOG: COG0541     Description: signal recognition particle protein Gene: mlr4380     GI: 13473695     BI number: mlr4380     GOG: COG1605     Description: chorismate mutase Gene: mlr4381     GI: 13473696     BI number: mlr4381     GOG: COG0228     Description: ribosomal protein S1            gg           t  a            cg            cg   t       |  c t  t      |  c cg       t  a        a ta       a  a      a  t cg       g  c       cg cg       a  a       gc gc       c  c       cg a  c      a  c       gc a  a      a  c      a  c g  a      a  g      c  c c  |       tg        gc cg        gc        gc gt        ta        cg cg        cg        cg a  |       gc        cg gc        tg        at gt        gc        cg                         ctttttggttttgggctttgcttttgcttggacagttggcgcgaacgcattacctctcgggcatcatccgggtgccagggaaaaggaaaacgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0541 Signal recognition particle GTPase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [J] COG0228 Ribosomal protein S16 ... can be seen here     ..................................................................................................................