                                                                        Gene putatively regulated by attenuation in M_jannaschii

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:158 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.90 kcal/mol
Antiterminator:    Distance from promoter:134 nt. Size=37 nt.     Delta G= -8.05 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaga-tagttt. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttagagagaaaggtttttatattagtttaattatacttactcaccaagaagtgatatatcaccaataagtgggtaaatgaccacccaaggataaccagc
tttaacggctgggaccccttgggtgtgatgtaagccctgaaacacggcccccaccattaacccctcccccaccaaatataatttttttagacggggcgag
atgaagcccactatttaTTG

    MJ0356 --- MJ0355 Gene: MJ0356     GI: 15668532     BI number: MJ0356     GOG: -------     Description: M. jannaschii predicted coding region MJ0356 Gene: MJ0355     GI: 15668531     BI number: MJ0355     GOG: -------     Description: M. jannaschii predicted coding region MJ035 at a  t t  t a  t t  t a  t       at a  t      g  g a  a      a  a c  g      g  a c  a       cg a  c       gc cg        gc cg        gc cg       g  a cg       c  | |  c      a  | cg        gc ta        at cg        ta             tttaTTG                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................