                                                                        Gene putatively regulated by attenuation in M_tuberculosis_H37Rv

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATgtcggtccaaacttaccgccgcgcggcgacgagtcggcggaccgcggcatagcctggccaggctcatcgccacgcggcaggtccttcggcgcc
accacccaattttgggtgcacttttcccgccaagtttttgcgcgggcgcgtccgttgatggcacactcggttcgtgctcaacgcgcagcgccgatttttc
tacgggtaccggccagcggtgcccgtggtctagctgctttcgcagagccccgtggtccgcttccggattcggggctcgtctcttgtgtgaggcccagtac
cggATG

    Rv0948c Gene: Rv0948c     GI: 15608088     BI number: Rv0948c     GOG: COG1605     Description: hypothetical protein Rv0948 tt g  t at at cg |  c cg gc cg cg cg t  c t  |       gg t  |      t  c t  |      a  a c  |       gc a  |       ta         a cg       |  c      c  a gc       t  t      t  c t  g       gc        cg g  t       cg        gc gc        cg        tg gc       |  t       gc tg       t  t      |  a t  t       gc       c  g t  t       cg       t  c t  g       gt        tg a  a       cg        gc at        gc        gc cg        gt        cg cg        gc        ta                         tttttctacgggtaccggccagcggtgcccgtggtctagctgctttcgcagagccccgtggtccgcttccggattcggggctcgtctcttgtgtgaggcccagtaccggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in M_tuberculosis_H37Rv                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:163 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-11.52 kcal/mol Antiterminator: Size=34 nt.     Delta G=-10.00 kcal/mol Anti-antiterminator:   Size=32 nt.     Delta G=-12.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TCATgtcggtccaaacttaccgccgcgcggcgacgagtcggcggaccgcggcatagcctggccaggctcatcgccacgcggcaggtccttcggcgcc accacccaattttgggtgcacttttcccgccaagtttttgcgcgggcgcgtccgttgatggcacactcggttcgtgctcaacgcgcagcgccgatttttc tacgggtaccggccagcggtgcccgtggtctagctgctttcgcagagccccgtggtccgcttccggattcggggctcgtctcttgtgtgaggcccagtac cggATG     Rv0948c Gene: Rv0948c     GI: 15608088     BI number: Rv0948c     GOG: COG1605     Description: hypothetical protein Rv0948                      tt                     a  t             a        at           c  c       cg gc        cg        cg g  c       gc        cg ta        cg        at cg        tg        cg cg       a  c      |  c gc       c  a      |  a at        tg       |  c |  c       cg       |  t ta       |  t      |  t at        gc       c  t |  c       gc       a  t cg        at       c  c gc       |  t      c  c gc       |  c       gc c  a       cg        cg gc        cg        gc cg        gc        gc                         aagtttttgcgcgggcgcgtccgttgatggcacactcggttcgtgctcaacgcgcagcgccgatttttctacgggtaccggccagcggtgcccgtggtctagctgctttcgcagagccccgtggtccgcttccggattcggggctcgtctcttgtgtgaggcccagtaccggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................