                                                                        Gene putatively regulated by attenuation in M_gallisepticum

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:85 nt. Size=37 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=59 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgaga-tataat. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgagattttttttatatctatgtataataaaaatcaataacagaggtacctcttttatcttggataaaagaagttgagaaacactcttatgagctgatc
tggttaacaccagcgtagcgagttatatctctcacaagtgtgcctccttatttaaattcaaatttaaaaaaggagtttttttATG

    hatA --- hatB --- hatC Gene: hatA     GI: 31544422     BI number: MGA_1017     GOG: NOG06352     Description: HatA Gene: hatB     GI: 31544423     BI number: MGA_1018     GOG: COG3638     Description: HatB Gene: hatC     GI: 31544424     BI number: MGA_1019     GOG: COG3639     Description: Hat aa t  c ta gc gc ta cg t  c a  g gt ta cg gc a  | g  | t  |       ca a  |      t  c t  |      c  a t  |       ta        ca cg        cg       t  a ta       t  |       ta cg        at        at at        tg        at |  t       at        at |  a       tg        ta |  t      t  c       ta c  a       gc        ta a  t       at       a  a a  c       gc        ta at       c  c       ta gc        gt        cg at        at        cg gc        ta        ta ta        gt        cg                         tttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in M_gallisepticum This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.70 kcal/mol Antiterminator: Size=39 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ataaacaagaaacagaattgtttagaagaataaaaatcaaatttttattagataaataaccaatcaagacagaacatggcttatcgcagcacttaatcag tcttaccaatgtcaattggtgagattttttttatatctatgtataataaaaatcaataacagaggtacctcttttatcttggataaaagaagttgagaaa cactcttatgagctgatctggttaacaccagcgtagcgagttatatctctcacaagtgtgcctccttatttaaattcaaatttaaaaaaggagttttttt ATG     hatA --- hatB --- hatC Gene: hatA     GI: 31544422     BI number: MGA_1017     GOG: NOG06352     Description: HatA Gene: hatB     GI: 31544423     BI number: MGA_1018     GOG: COG3638     Description: HatB Gene: hatC     GI: 31544424     BI number: MGA_1019     GOG: COG3639     Description: Hat tc a  g t  c ta cg gc |  a       tc g  c      g  a t  t       ta a  t       at c  a       at a  a       cg at        cg gc        at a  a       tg cg        ta at        cg gc        ta at        gt at        at             ttttttatatctatgtataataaaaatcaataacagaggtacctcttttatcttggataaaagaagttgagaaacactcttatgagctgatctggttaacaccagcgtagcgagttatatctctcacaagtgtgcctccttatttaaattcaaatttaaaaaaggagtttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................