                                                                        Gene putatively regulated by attenuation in M_mycoides

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=30 nt.     Delta G= -5.94 kcal/mol
Anti-antiterminator:    Distance from promoter:42 nt.    Size=32 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg
tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG

    phnD --- phnC_lrep_1 --- phnB Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen aa t  t       tt gt       t  t        a gc       a  t      t  a ta       g  t      t  a at       a  a      c  a cg       a  c       cg t  c      a  a       cg a  g       tg        gt g  t       cg        ta a  g       gt        at cg        gt        ta gc        ta        ta at        gt        gc ta        cg        gc ta        gc        at                         tttatttttcccttattttaaaaaggagataagaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in M_mycoides This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:85 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.30 kcal/mol Antiterminator:    Distance from promoter:49 nt. Size=30 nt.     Delta G= -5.94 kcal/mol Anti-antiterminator:    Distance from promoter:15 nt.    Size=43 nt.     Delta G= -6.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG     phnD --- phnC_lrep_1 --- phnB Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen   t a  a t  c t  c a  t g  a at gt        tg ta       a  c        a cg       c  g      t  a gc       t  t      t  a g  a      t  g      c  a a  g      a  g       cg a  a      a  c       cg a  t       tt        gt a  c       ga        ta ta        ga        at gt        ta        ta tg        ag        ta cg        ca        gc gt        tt        gc ta        at        at                         tttatttttcccttattttaaaaaggagataagaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in M_mycoides This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:42 nt.    Distance to gene:62 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -8.30 kcal/mol Antiterminator:    Distance from promoter:15 nt. Size=43 nt.     Delta G= -6.40 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -5.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG     phnD --- phnC_lrep_1 --- phnB Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen aa t  g a  g a  g at tg gc at         t a  g      a  a at       t  c ta       t  c ta       a  t a  a      g  a a  a       at        aa t  g       gt       t  t a  |       ta        gt tg        cg        gc gc        gc        ta at       g  a       at a  g      a  g       cg a  |      a  a      t  c t  |      a  t      a  g t  |      a  c      g  t a  |       ta       a  g ta        gt        cg cg        tg        gc ta        cg        at at        gt        ta gt        ta        ta                         agattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................