Gene putatively regulated by attenuation in M_mycoides

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=30 nt.     Delta G= -5.94 kcal/mol
Anti-antiterminator:    Distance from promoter:42 nt.    Size=32 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg
tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG

    phnD --- phnC_lrep_1 --- phnB


Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin
Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component
Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen


 aa
t  t       tt
 gt       t  t        a
 gc       a  t      t  a
 ta       g  t      t  a
 at       a  a      c  a
 cg       a  c       cg
t  c      a  a       cg
a  g       tg        gt
g  t       cg        ta
a  g       gt        at
 cg        gt        ta
 gc        ta        ta
 at        gt        gc
 ta        cg        gc
 ta        gc        at
                        tttatttttcccttattttaaaaaggagataagaATG


                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in M_mycoides

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=30 nt.     Delta G= -5.94 kcal/mol
Anti-antiterminator:    Distance from promoter:15 nt.    Size=43 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg
tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG

    phnD --- phnC_lrep_1 --- phnB


Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin
Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component
Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen


  t
a  a
t  c
t  c
a  t
g  a
 at
 gt        tg
 ta       a  c        a
 cg       c  g      t  a
 gc       t  t      t  a
g  a      t  g      c  a
a  g      a  g       cg
a  a      a  c       cg
a  t       tt        gt
a  c       ga        ta
 ta        ga        at
 gt        ta        ta
 tg        ag        ta
 cg        ca        gc
 gt        tt        gc
 ta        at        at
                        tttatttttcccttattttaaaaaggagataagaATG


                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in M_mycoides

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:42 nt.    Distance to gene:62 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:15 nt. Size=43 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-tataat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttatttcactaattgatctattaaagtataattaaagtaaataagggtgctgtaaaaggctgagattatacctattagcagatcatggtaattcatgcg
tggctaaagattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG

    phnD --- phnC_lrep_1 --- phnB


Gene: phnD     GI: 42561313     BI number: MSC_0790     GOG: -------     Description: Alkylphosphonate ABC transporter, substrate-bindin
Gene: phnC_lrep_1     GI: 42561312     BI number: MSC_0078     GOG: -------     Description: alkylphosphonate ABC transporter, ATP-binding component
Gene: phnB     GI: 42561311     BI number: MSC_0788     GOG: -------     Description: Alkylphosphonate ABC transporter, permease componen


 aa
t  g
a  g
a  g
 at
 tg
 gc
 at         t
a  g      a  a
 at       t  c
 ta       t  c
 ta       a  t
a  a      g  a
a  a       at        aa
t  g       gt       t  t
a  |       ta        gt
 tg        cg        gc
 gc        gc        ta
 at       g  a       at
a  g      a  g       cg
a  |      a  a      t  c
t  |      a  t      a  g
t  |      a  c      g  t
a  |       ta       a  g
 ta        gt        cg
 cg        tg        gc
 ta        cg        at
 at        gt        ta
 gt        ta        ta
                        agattttttacaggttatgcccttaaaaggtataaccttttatttttcccttattttaaaaaggagataagaATG


                                                                        Genes that have a predicted attenuator with a riboswitch:

Thiamine_Thi-box sequence ... can be seen here

    ..................................................................................................................