                                                                        Gene putatively regulated by attenuation in M_penetrans

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:176 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.00 kcal/mol
Antiterminator:    Distance from promoter:130 nt. Size=54 nt.     Delta G=-15.20 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=41 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgagt-tttatt. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagtttattcaactctattttttatttgaaattaatataactaacatttatgtaaatacttaaatttaagatttataatcaaaatatgttatcaggcg
gtgccattaaaatatggctgagaaaatacgcttatgacctgatctagttagtactagcggaggcaagtgataatatataaatttgaatttgtatatttat
ttctaagtctccataacaatggagacttttttatttattgctgataactaaggtaaataaaATG

    MYPE6620 --- MYPE6610 --- MYPE6600 Gene: MYPE6620     GI: 26554116     BI number: MYPE6620     GOG: NOG06352     Description: high affinity transport system protein Gene: MYPE6610     GI: 26554115     BI number: MYPE6610     GOG: COG3638     Description: ABC transporter ATP-binding protein Gene: MYPE6600     GI: 26554114     BI number: MYPE6600     GOG: COG3639     Description: transport system permeas            tg           t  a            ta            at            at            at ag        tg t  t       at ta        ta gc        at at        ta ta       |  t cg        at t  c       at a  g       ta g  g       at ta        gt        ac cg       t  t      a  a cg        gc        ta a  |       at        at gc       |  a       cg ta       a  a       cg a  |       cg        ta t  |       gt        cg ta        gc        ta cg        at        gc gt        gc        at cg        gc        at                         ttttatttattgctgataactaaggtaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in M_penetrans This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:178 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.50 kcal/mol Antiterminator:    Distance from promoter:140 nt. Size=54 nt.     Delta G=-15.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgagt-tttatt. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgagtttattcaactctattttttatttgaaattaatataactaacatttatgtaaatacttaaatttaagatttataatcaaaatatgttatcaggcg gtgccattaaaatatggctgagaaaatacgcttatgacctgatctagttagtactagcggaggcaagtgataatatataaatttgaatttgtatatttat ttctaagtctccataacaatggagacttttttatttattgctgataactaaggtaaataaaATG     MYPE6620 --- MYPE6610 --- MYPE6600 Gene: MYPE6620     GI: 26554116     BI number: MYPE6620     GOG: NOG06352     Description: high affinity transport system protein Gene: MYPE6610     GI: 26554115     BI number: MYPE6610     GOG: COG3638     Description: ABC transporter ATP-binding protein Gene: MYPE6600     GI: 26554114     BI number: MYPE6600     GOG: COG3639     Description: transport system permeas ta a  t tt gt ta tt tt at ac gt ta |  a tg tt ac at ac t  c aa        ac tt       a  a |  a       ta a  a       at tc        cg aa        cg a        ta t        cg a        ta g        gc             ttttttatttattgctgataactaaggtaaataaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3638 ABC-type phosphate/phosphonate transport system, ATPase component ... can be seen here [P] COG3639 ABC-type phosphate/phosphonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................