                                                                        Gene putatively regulated by attenuation in N_meningitidis_MC58

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:156 nt.    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:96 nt. Size=65 nt.     Delta G=-27.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-tttaat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacaaaagttcatgttcgtgatttaattttggttaacattgaaacaggggtgctgcctgatgtttaggcggctgagaaataccctttacacccgatcg
ggataatacctgcgtggggagttttcacggattctgcttttcagacggcattggttttcaaatgccgtctgaaaacgcaaaacgctcctgtttctttaat
tctaaacgagaaaacaggagcatttttttATG

    NMB2040 Gene: NMB2040     GI: 15677863     BI number: NMB2040     GOG: COG0422     Description: thiamine biosynthesis protein Thi tt t  t g  c g  a ta ta at cg gc gc cg at gc at cg ta ta ta         c ta       t  t |  c      t  a cg       a  a gc       a  a ta       t  c c  a       tg ta        ta ta        cg |  c      |  a |  g       ta |  c       ta at        ta gc        gc gc        ta c  |       cg at        cg cg        ta             gcatttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................