                                                                        Gene putatively regulated by attenuation in N_meningitidis_Z2491

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggaatgacgggattttatagtggattaacaaaaatcaggacaaggcggcgagccgcagacagtacagatagtacggaaccgattcacttggtgcttcagc
accttagagaatcgttctctttgagctaaggcaaggcaacgccgtactggtttttgttaatccactatatcgttccggttcgtccggttttgccggggct
tttgttgccgcctgtttgtgccggtgtgttaaaattttccgtttccgcgtattgtgttttccgccgccgggcggtttgtttgcgaatcggacgagaattt
ATG

    NMA2040 --- pheA --- recO --- pdxJ Gene: NMA2040     GI: 15794920     BI number: NMA2040     GOG: COG0477     Description: putative integral membrane efflux protein Gene: pheA     GI: 15794919     BI number: NMA2039     GOG: COG0077,COG1605     Description: chorismate mutase Gene: recO     GI: 15794918     BI number: NMA2038     GOG: COG1381     Description: DNA repair protein (recombination protein o) Gene: pdxJ     GI: 15794917     BI number: NMA2037     GOG: COG0854     Description: pyridoxal phophate biosynthetic protei             g           t  t           t  t            ta            ta gc       t  t g  a       gc a  a       gc a  c       ta        cg cg       c  c      c  g gc        at       t  t gc        ta       g  t |  g       gt       c  t |  t      c  a      t  t |  a      c  t       tg a  c       gc        gc at        cg        gc tg        at        cg cg        at        cg gt       c  |       tg at        gc        tg gt        gc        gc                         ttttgttgccgcctgtttgtgccggtgtgttaaaattttccgtttccgcgtattgtgttttccgccgccgggcggtttgtttgcgaatcggacgagaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [L] COG1381 Recombinational DNA repair protein (RecF pathway) ... can be seen here [H] COG0854 Pyridoxal phosphate biosynthesis protein ... can be seen here     ..................................................................................................................