                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:163 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-19.20 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=75 nt.     Delta G=-21.74 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=47 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgaca-tacagt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgacagaatttatttattttgttacagttaatatgaagtaaataaatacgaaaagcaactactaggggtgcccagtactatgtgtgggctgagaggaaa
gcacctactttccgactcttatggacctgatctggttaataccagcgtagggaagtagtcaataattttgatgattacattctcagtataccaaaaccag
gtcctttaattggacctggttttttgtttgttttaaaaaggagagataaaGTG

    OB0476 --- OB0475 --- OB0474 --- OB0473 --- OB0472 Gene: OB0476     GI: 23097931     BI number: OB0476     GOG: COG4732     Description: hypothetical protein Gene: OB0475     GI: 23097930     BI number: OB0475     GOG: COG0819     Description: transcriptional activator of extracellular enzymes Gene: OB0474     GI: 23097929     BI number: OB0474     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: OB0473     GI: 23097928     BI number: OB0473     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: OB0472     GI: 23097927     BI number: OB0472     GOG: COG0352     Description: thiamine phosphate synthase chain            tt           a  t            at            tg           a  a            at            cg            ta            gt            at            ta            gc           |  a aa        at t  t       at ta        gc gc        gt gc        gc ta       a  a cg       t  | t  c      g  | a  g       cg gt        gt ta       a  a        a cg       c  t      t  a cg       c  a      t  t a  g      a  c      t  t g  |      t  c       cg g  |      a  a       cg t  |      a  a       ta a  |       ta        gc ta        ta        gc ta        gc        at cg        gc        cg |  t       ta        cg ta        cg        at cg        tg        at at        at        at gc        gc        at                         ttgtttgttttaaaaaggagagataaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in O_iheyensis This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:165 nt.    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.40 kcal/mol Antiterminator:    Distance from promoter:129 nt. Size=75 nt.     Delta G=-21.74 kcal/mol Anti-antiterminator:    Distance from promoter:115 nt.    Size=43 nt.     Delta G= -9.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: atgaca-tacagt. It has a score value of 66.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgacagaatttatttattttgttacagttaatatgaagtaaataaatacgaaaagcaactactaggggtgcccagtactatgtgtgggctgagaggaaa gcacctactttccgactcttatggacctgatctggttaataccagcgtagggaagtagtcaataattttgatgattacattctcagtataccaaaaccag gtcctttaattggacctggttttttgtttgttttaaaaaggagagataaaGTG     OB0476 --- OB0475 --- OB0474 --- OB0473 --- OB0472 Gene: OB0476     GI: 23097931     BI number: OB0476     GOG: COG4732     Description: hypothetical protein Gene: OB0475     GI: 23097930     BI number: OB0475     GOG: COG0819     Description: transcriptional activator of extracellular enzymes Gene: OB0474     GI: 23097929     BI number: OB0474     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: OB0473     GI: 23097928     BI number: OB0473     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: OB0472     GI: 23097927     BI number: OB0472     GOG: COG0352     Description: thiamine phosphate synthase chain            ac           a  c            aa            ag           c  g            ct            ac            tc            at            tt            gt            aa           |            c            t            c tt        t a  t       t at       a tg       c  | a  a      a  | at        t cg        t ta       a gt       g at       t          a ta       a        t  a gc       g        t  t |  a      t        t  t at       t         cg at        t        cg gc        t        ta gt        a        gc gc        a        gc a  a       t        at t  |       a        cg g  |       a        cg cg        c        at gt        t        at                         ttttgtttgttttaaaaaggagagataaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................