                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:26 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:107 nt. Size=45 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:106 nt.    Size=24 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttact-taagat. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacttttacgaaaaaatcaactaagatgtaggtagaataaaaaaaaatccactaggggtgccattttggctgagataagatgcatttcttgatccctt
tgaacctgaactggttaataccagcgtaggaaagtggagttggcgactatacctattctgtagctgtatataaaaccactccattttggggtggtttatt
tgttctttattctaaattaataggagaggagaatttTTG

    OB0643 --- OB0642 --- OB0641 Gene: OB0643     GI: 23098098     BI number: OB0643     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: OB0642     GI: 23098097     BI number: OB0642     GOG: NOG15692     Description: hypothetical protein Gene: OB0641     GI: 23098096     BI number: OB0641     GOG: COG0819     Description: transcriptional activator of extracellular enzym             c           t  t            tg            at            ta            cg           |  c           |  t            cg            at            ta            at            ta         t ct       |  t      t  t a  a      c  a      a  t g  t      a  a       cg c  a      g  a       cg gc       c  a       tg gc        gc        cg t  t       gc        at ta       t  |       cg gt        ta        cg at        gc        at gc        at        at gt        gc        at                         atttgttctttattctaaattaataggagaggagaatttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in O_iheyensis This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:143 nt.    Distance to gene:33 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-14.20 kcal/mol Antiterminator:    Distance from promoter:107 nt. Size=45 nt.     Delta G= -6.40 kcal/mol Anti-antiterminator:    Distance from promoter:71 nt.    Size=24 nt.     Delta G= -3.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: tttact-taagat. It has a score value of 70.28 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case tttacttttacgaaaaaatcaactaagatgtaggtagaataaaaaaaaatccactaggggtgccattttggctgagataagatgcatttcttgatccctt tgaacctgaactggttaataccagcgtaggaaagtggagttggcgactatacctattctgtagctgtatataaaaccactccattttggggtggtttatt tgttctttattctaaattaataggagaggagaatttTTG     OB0643 --- OB0642 --- OB0641 Gene: OB0643     GI: 23098098     BI number: OB0643     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: OB0642     GI: 23098097     BI number: OB0642     GOG: NOG15692     Description: hypothetical protein Gene: OB0641     GI: 23098096     BI number: OB0641     GOG: COG0819     Description: transcriptional activator of extracellular enzym             c           t  t            tg            at            ta            cg           |  c           |  t            cg            at            ta            at            ta         t tg       |  t      t  t c  g      c  a      a  t a  t      a  a       cg a  t      g  a       cg ga       c  a       tg ta        gc        cg c  t       gc        at ca       t  |       cg ac        ta        cg ac        gc        at ga        at        at tg        gc        at                         atttgttctttattctaaattaataggagaggagaatttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [K] COG0819 Putative transcription activator ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................