                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgtatatcctcgataatatggttcgaaagtatctaccgggtcaccgtaaatgatctgactatgaaggcagaagcaggttcggttaaggtacctggatttc
tgtctttttagatagctatgtctatatagctagtgaagggcagttttccaggttttttcataggtaaatgtttttcgtattatacatttattttcgaatg
gatatagtcatatactttccaaggtatacggtatgcctacgaaacacaaactaataatatcaaagacaagcctatagtaagtatagataggagagcgatt
ATG

    guaA Gene: guaA     GI: 23098171     BI number: OB0716     GOG: COG0518,COG0519     Description: GMP synthas            ta           c  t           a  g           g  a            ta            cg        tt            tg       g  a           a  |      g  a            gc        cg            ta        tg           a  g      |  t           a  a       ta           a  a       gc            tg        gc            gc        at   t       c  a       cg g  a      c  |      |  g c  a      a  |      |  a c  a       cg        gt at        tg        at cg       g  t       at ta       g  t       gc gt        gc        at gc        cg        cg gt        cg        gt cg        at        gc                         tttttagatagctatgtctatatagctagtgaagggcagttttccaggttttttcataggtaaatgtttttcgtattatacatttattttcgaatggatatagtcatatactttccaaggtatacggtatgcctacgaaacacaaactaataatatcaaagacaagcctatagtaagtatagataggagagcgattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0518 GMP synthase - Glutamine amidotransferase domain ... can be seen here [F] COG0519 GMP synthase, PP-ATPase domain/subunit ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................