                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:112 nt. Size=70 nt.     Delta G=-22.27 kcal/mol
Anti-antiterminator:    Distance from promoter:83 nt.    Size=53 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaca-tatgat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttacatttgaatgaatattgcttatgatgaaactataataaataaaactgcatattctatcgtacgcactaggggagctataactatggctgagaaggc
aatgcctgacccttataacccgaactagataatactagcgtggggaagtgtagttcgttgtatgaatatatatttactttttttcattcatatatacaaa
ctgcattcccttaggagtgcagtttttttattgcccaaaaataaggaggaatacacgATG

    OB0806 --- OB0805 --- OB0804 --- OB0803 Gene: OB0806     GI: 23098261     BI number: OB0806     GOG: NOG13653     Description: hypothetical protein Gene: OB0805     GI: 23098260     BI number: OB0805     GOG: COG4721     Description: hypothetical protein Gene: OB0804     GI: 23098259     BI number: OB0804     GOG: COG1122     Description: cation ABC transporter ATP-binding protein Gene: OB0803     GI: 23098258     BI number: OB0803     GOG: COG0619     Description: hypothetical protei            ac           t  t           t  t           t  t           a  t           t  t           a  t           t  t           a  c   c        ta g  g       at a  t       at tg        gc cg        ta a  g       at t  g       ta a  a       gt a  a       ta tg       |  t at        ta g  g       gc at       c  a ta        ta        tt cg        ta       c  a at        gc        cg at        at        cg gc        tg        ta cg        gc        tg c  t       ta        at c  t      g  |       cg a  g       at        gc at        at        ta ta        gc        cg at        gc        at tg        gc        at ta        gt        at                         ttttattgcccaaaaataaggaggaatacacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4721 Predicted membrane protein ... can be seen here [P] COG1122 ABC-type cobalt transport system, ATPase component ... can be seen here [P] COG0619 ABC-type cobalt transport system, permease component CbiQ and related transporters ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................