                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:130 nt.    Distance to gene:14 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:110 nt. Size=26 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:    Distance from promoter:63 nt.    Size=53 nt.     Delta G= -5.76 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tataat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaccttatatatagttttttcatataatcgcggggatatggcctgcaagtttctaccggtttaccgtaaatgaaccgactatggaaaagcggaaaa
ttcgatattctatctatcaaactcaaagactatcgtttttaaattttcgacatttcaagctcggaaatctgcttttttataggcggattttcgagctttt
tatattttaggaggaatggaagcATG

    OB1061 --- OB1062 Gene: OB1061     GI: 23098516     BI number: OB1061     GOG: COG0503     Description: xanthine phosphoribosyltransferase Gene: OB1062     GI: 23098517     BI number: OB1062     GOG: COG2233     Description: xanthine permeas   a c  a t  a a  c t  t c  c t  a a  a ta cg ta t  c at ta at gc                  tt cg                 t  a |  t       tc       t  t |  t      t  a       ta |  t      t  a       tg |  t      a  g       cg |  t      c  c       gc |  a       at        tg ta        gc        cg ta        cg        ta at        tg        at at        ta        at at        ta        at at        ta        gt gc        at        gc                         gagctttttatattttaggaggaatggaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here [F] COG2233 Xanthine/uracil permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in O_iheyensis This operon is putativelly rgulated by Guanine_G-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:127 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-20.00 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaaa-tataat. It has a score value of 76.97 and is shown in blue ttgaaaccttatatatagttttttcatataatcgcggggatatggcctgcaagtttctaccggtttaccgtaaatgaaccgactatggaaaagcggaaaa ttcgatattctatctatcaaactcaaagactatcgtttttaaattttcgacatttcaagctcggaaatctgcttttttataggcggattttcgagctttt tatattttaggaggaatggaagcATG     OB1061 --- OB1062 Gene: OB1061     GI: 23098516     BI number: OB1061     GOG: COG0503     Description: xanthine phosphoribosyltransferase Gene: OB1062     GI: 23098517     BI number: OB1062     GOG: COG2233     Description: xanthine permeas           tt          t  a          t  t           ta           tg           cg           gc           tg           cg           ta           at           at           at           gt           gc           cg           ta           cg             ctttttatattttaggaggaatggaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here [F] COG2233 Xanthine/uracil permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................