                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.00 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aatcatattcataggttttggatagaggtgcggagaccatcagtatatacgcggaagggaaatgagccctagtgaagcgtatggaaaggggaatctgccg
aagcgagtgaaatactcattcattaactcgttggtgctgctattgaacaaataacagtgctgtcatataggagactatatggagggctatcgagctggga
acttatatgttcagcagcaacgggcttccgttggtgctttttaatttggcccaaccctcttaaagcaagtttgttcaaattataaaaagggtgtgtttac
ATG

    dapA Gene: dapA     GI: 23099163     BI number: OB1708     GOG: COG0329     Description: dihydrodipicolinate synthas ag g  a gc        at at       t  a ta       t  t at        cg ta        at at        at cg        gc tg       |  a |  a      g  g g  g       gc tg        ta cg        cg        ct gc        gc       g  t |  t      a  a       gc |  a      g  a       gc |  t      c  c       cg |  c      t  g       at |  g      a  |       at |  a       tg        cg tg        cg       g  g gc        gc        at at        gt        cg cg        gt        gc                         tttttaatttggcccaaccctcttaaagcaagtttgttcaaattataaaaagggtgtgtttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EM] COG0329 Dihydrodipicolinate synthase/N-acetylneuraminate lyase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................