                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:205 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:171 nt. Size=46 nt.     Delta G= -6.72 kcal/mol
Anti-antiterminator:    Distance from promoter:144 nt.    Size=52 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttatt-caaaat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttattttggtacttagtataaccaaaatatacatatttcatcagcggaagattacaaggggagagtttacaacgaatagtaacgccgaaggagcaagtg
aagagcgaatctctcaggccaaaaagactcttgtatgacgcaactctggagagtgtttacgaaggtaaaccacccacgaagcaaatatttgttctttttt
gaagaatgaatatgcaactttctggtataaggacagagatttcttcactatggaggagtctctatttttATG

    OB1904 --- OB1903 --- OB1902 Gene: OB1904     GI: 23099359     BI number: OB1904     GOG: COG0404     Description: aminomethyltransferase Gene: OB1903     GI: 23099358     BI number: OB1903     GOG: COG0403     Description: glycine dehydrogenase subunit 1 Gene: OB1902     GI: 23099357     BI number: OB1902     GOG: COG1003     Description: glycine dehydrogenase subunit             a           t  a   t       a  g t  t      t  g tg       g  a ta        gc ta        ta cg        cg ta        ta ta        tg g  t       ta t  g      c  t ta       a  | ta       a  | at       c  |        t ta       g  |      c  a at       t  |      a  t |  g      a  |       cg a  c      t  |       tg a  a      a  |       ta c  a      a  |       cg gc       g  |       tg at       t  |       ta at        at        tg gt        at        at c  c       gc        gc at        at        at cg        at        gc cg        gc        at                         atttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here [E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here [E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................