                                                                        Gene putatively regulated by attenuation in O_iheyensis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaaagaactccggtttaaaactggagttcttttttcttgggggaagaaagtataagtcagatggcctttttaacatctattcaaattaatacccttgta
gtgaaatcatcatccactcttccctaagaagttcgacttctgtggaatccccctaaataacagggccacacttgctgcgtttctaaatgggcgcatgtgt
gtttgttcatttcttataaaaatttccttttgctttttatgagtcattcttttgctttctccctttttctgctatactcagttttaatgaggtgaaatcg
ATG

    OB2043 --- obg --- pheA Gene: OB2043     GI: 23099498     BI number: OB2043     GOG: NOG13853     Description: hypothetical protein Gene: obg     GI: 23099497     BI number: OB2042     GOG: COG0536     Description: Spo0B-associated GTP-binding protein Gene: pheA     GI: 23099496     BI number: OB2041     GOG: COG0077     Description: prephenate dehydratas                      aa             t       t  a           a  a      c  t           a  a       tg   c       a  c       tg t  g       ta        tg t  a       cg        gc gc        cg        cg at        cg        gc at       c  |       ta gc       c  |      c  t at       t  |      g  | a  g      a  |      t  | t  t      a  |      t  | c  |       gc        cg cg        gc        at cg        ta        cg ta        gc        at ta        ta        cg                         tttgttcatttcttataaaaatttccttttgctttttatgagtcattcttttgctttctccctttttctgctatactcagttttaatgaggtgaaatcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here     ..................................................................................................................