                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions

tatttctaacaaataaatattcgattccaatcttcggggcagggtgcaattcccgaccggcggtaaagtccgcgagctgcatacatattgtggttgatct
ggttaaattccagtaccgacagttatagtctggatgggagaagatgtcgatcatgtttgtgttacacattttttgtgtgcatttttgacgatgtattcaa
accctagggcctcgctctagggttttattaattgtaatacaaacggttaatcgtccttcatcacaagataggaatcgaatgaactgatggaggagaaata
ATG

    OB2329 Gene: OB2329     GI: 23099784     BI number: OB2329     GOG: COG3601     Description: hypothetical protei            t          c  c           cg           gc           gt           gc           at           ta           cg           cg           cg           at             tttattaattgtaatacaaacggttaatcgtccttcatcacaagataggaatcgaatgaactgatggaggagaaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3601 Predicted membrane protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................