                                                                        Gene putatively regulated by attenuation in O_iheyensis

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cattagtaatcgacaagaggatgacaacgatgatagttggtggaagggttgtttgccgaagcataataagggtcagacttattattgctggtacatcttt
gaataaaagatgcactgtcatgcaaaattaagtgcatggagaactactgatcgaaatggaggataacgttagttggtaaaacaatgatggttattttctg
tcgttgttttttttgtgcttaaaaatagcaacgttgctttacatcaagagcatttcgggtattatctccatcaccaaataattatttggaggtaacaact
ATG

    OB2369 Gene: OB2369     GI: 23099824     BI number: OB2369     GOG: COG1757     Description: hypothetical protei ga g  t                  t a  a       aa       a  t g  a      t  a      t  t gc       g  a      t  t tg        gc        gc at        ta        gt at        ta        tg a  a       gt        at g  |      a  g       gc c  |      t  a       tg tg       t  t       at at       g  g       at g  t       cg        cg t  g       at        at cg        at        at at        ta        at ta        at        at                         ttttgtgcttaaaaatagcaacgttgctttacatcaagagcatttcgggtattatctccatcaccaaataattatttggaggtaacaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1757 Na+/H+ antiporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................