                                                                        Gene putatively regulated by attenuation in P_multocida

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aattgaccctacgccgacgaggtaaactctttcaggcgctgattataagcagggactgttactggacgaacccttggagagagccgttatattaaaaaga
gataaaacggccgccgaaggcgcaaaaagagcggttaatttttccgttttttcaaacgctcaggcaaaaggacaggggcaacaagatattcggtttgatg
tttacatgcatggactacatgcgtgcttttctcttttttaactcttccgcaaaatgcttttgcctccttgtaatctgtgattttttacgaggatcttatc
ATG

    PM0091 Gene: PM0091     GI: 15601956     BI number: PM0091     GOG: COG1115     Description: unknow            gt           g  t           c  t            tg ca        ta t  g       at cg        tg gc        at c  a       gt a  |       at a  |      a  a a  |      c  c c  |      a  a ta        at ta        cg         c ta        gc       a  t tg       g  a      g  a tg       g  |       gc ta       g  |       ta gc        at        at |  a       cg        cg cg       a  g       gc cg       g  a       tg tg        gc        at tg        at        cg                         cttttctcttttttaactcttccgcaaaatgcttttgcctccttgtaatctgtgattttttacgaggatcttatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in P_multocida This operon is putativelly rgulated by Glycine_cleavage                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:69 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-10.40 kcal/mol Antiterminator: Size=48 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aattgaccctacgccgacgaggtaaactctttcaggcgctgattataagcagggactgttactggacgaacccttggagagagccgttatattaaaaaga gataaaacggccgccgaaggcgcaaaaagagcggttaatttttccgttttttcaaacgctcaggcaaaaggacaggggcaacaagatattcggtttgatg tttacatgcatggactacatgcgtgcttttctcttttttaactcttccgcaaaatgcttttgcctccttgtaatctgtgattttttacgaggatcttatc ATG     PM0091 Gene: PM0091     GI: 15601956     BI number: PM0091     GOG: COG1115     Description: unknow            cg           t  g           t  t            at ca        tt t  g       ag cg        ga gc        at c  a       ag a  |       ct a  |      a  t a  |      a  t c  |      c  a ta        gc ta        ga         c ta        gt       a  t tg       g  g      g  a tg       a  |       gc ta       c  |       ta gc        ac        at |  a       ga        cg cg       g  t       gc cg       a  g       tg tg        ag        at tg        aa        cg                         cttttctcttttttaactcttccgcaaaatgcttttgcctccttgtaatctgtgattttttacgaggatcttatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................