                                                                        Gene putatively regulated by attenuation in P_multocida

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAGATTAAgtttgcgttatactatttgcgcattctcagggcagggtgaaattccctaccggtggtaaatgtataacataagcccacgagcg
tttactatttcatgtcacaagagatagtaaagtcagcagatttggtgagaatccaaagccgacagtatagtctggatgaaagagaataagcaggttttgt
gtgcaaaacctgtattttttgtttgtttaagattttcttagccacatacttttctcatcagccctgattctggtatctaaatatctttatatttcaagga
atttactATG

    ribB Gene: ribB     GI: 15603250     BI number: PM1385     GOG: COG0108     Description: Rib   g a  a g  a t  t gc         t gc       a  g ta       g  a ta       g  a ta        ta a  |       cg        gt g  |       ta       t  g a  |      g  g       gc cg       a  a       ta gc        ta        ta a  c       at        ta cg        ta        ta ta       g  a       gc gc       a  g       gc a  a      c  c       at a  g      a  a       cg at       g  |       gt ta        cg       a  | gt        cg       a  | a  a       gt        ta tg        at        at at        at        at gc        at        gt at        cg        at                         ttgtttgtttaagattttcttagccacatacttttctcatcagccctgattctggtatctaaatatctttatatttcaaggaatttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in P_multocida This operon is putativelly rgulated by Riboflavin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.10 kcal/mol Antiterminator: Size=46 nt.     Delta G= -9.20 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-12.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TCGAGATTAAgtttgcgttatactatttgcgcattctcagggcagggtgaaattccctaccggtggtaaatgtataacataagcccacgagcg tttactatttcatgtcacaagagatagtaaagtcagcagatttggtgagaatccaaagccgacagtatagtctggatgaaagagaataagcaggttttgt gtgcaaaacctgtattttttgtttgtttaagattttcttagccacatacttttctcatcagccctgattctggtatctaaatatctttatatttcaagga atttactATG     ribB Gene: ribB     GI: 15603250     BI number: PM1385     GOG: COG0108     Description: Rib   g g  t t  g t  a tg         t aa       a  g ga       g  a at       g  a cc        ta g  |       cg a  |       ta c  |      g  g tc       a  a ga        ta a  a       at aa        ta ag       g  a       gt tc       a  g      t  g g  c      c  c       gc a  g      a  a       ta ta       g  |       ta ac        cg        ta ga        cg        ta a  g       gt        gc gt        at        gc aa        at        at at        at        cg ca        cg        gt                         attttttgtttgtttaagattttcttagccacatacttttctcatcagccctgattctggtatctaaatatctttatatttcaaggaatttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................