                                                                        Gene putatively regulated by attenuation in P_luminescens

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:2 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaagatgacgggtataaaccgccgttaggttaataccacaccttaatggtgtggttgggaaggaggtgaaagtcctccgcagcccccgctgctgtga
tgctgacaactccgctgatgccactggtcggaaagactgggaaggttgcggggaagggtgacgctaagccagaagaccgacctgacaggcacgagacatt
aactccttcggtgggaagcgagttgtcatccaagtggtgtgcgcggtgttggcacgtcttattggcgctccttttccgatcgacatatcgggaattttct
ATG

    cbiA --- cbiB --- cbiC --- cbiD --- cbiE --- cbiT --- cbiF --- cbiG --- cbiH --- cbiJ --- cbiK --- cbiL Gene: cbiA     GI: 37526889     BI number: plu2999     GOG: COG1797     Description: Cobyrinic acid A,C-diamide synthase Gene: cbiB     GI: 37526888     BI number: plu2998     GOG: COG1270     Description: CbiB protein Gene: cbiC     GI: 37526887     BI number: plu2997     GOG: COG2082     Description: Precorrin-8X methylmutase (Precorrin isomerase) Gene: cbiD     GI: 37526886     BI number: plu2996     GOG: COG1903     Description: Cobalamin biosynthesis protein CbiD Gene: cbiE     GI: 37526885     BI number: plu2995     GOG: COG2241     Description: Precorrin-6Y C5,15-methyltransferase [decarboxylating](precorrin-6 methyltransferase)(precorrin-6Y methylase) Gene: cbiT     GI: 37526884     BI number: plu2994     GOG: COG2242     Description: Precorrin-8W decarboxylase Gene: cbiF     GI: 37526883     BI number: plu2993     GOG: COG2875     Description: Precorrin-4 C11-methyltransferase (precorrin-3-methylase) Gene: cbiG     GI: 37526882     BI number: plu2992     GOG: COG2073     Description: Cobalamin biosynthesis protein G (CbiG) Gene: cbiH     GI: 37526881     BI number: plu2991     GOG: COG1010     Description: Precorrin-3B C17-methyltransferase (precorrin-3 methyltransferase) (precorrin-3 methylase) Gene: cbiJ     GI: 37526880     BI number: plu2990     GOG: COG2099     Description: Precorrin-6X reductase Gene: cbiK     GI: 37526879     BI number: plu2989     GOG: COG4822     Description: Cobalt chelatase Gene: cbiL     GI: 37526878     BI number: plu2988     GOG: COG2243     Description: Precorrin-2 C20-methyltransferase (S-adenosyl-L-methionine--precorrin-2 methyltransferase) (SP2MT             a           t  t           t  t            cg            tg            gc            cg           a  c   t       c  t g  g       gc g  t       gc tg       t  t gc       t  t a  g      g  t a  c      t  t       ac cg        gc       g  a cg        gc       c  t |  t       cg        ta |  g      |  a       at t  t      |  t       gc at        gc        cg cg        cg        cg tg       g  |       tg gc        ta        ta ta        gc        ta                         ttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1797 Cobyrinic acid a,c-diamide synthase ... can be seen here [H] COG1270 Cobalamin biosynthesis protein CobD/CbiB ... can be seen here [H] COG2082 Precorrin isomerase ... can be seen here [H] COG1903 Cobalamin biosynthesis protein CbiD ... can be seen here [H] COG2241 Precorrin-6B methylase 1 ... can be seen here [H] COG2242 Precorrin-6B methylase 2 ... can be seen here [H] COG2875 Precorrin-4 methylase ... can be seen here [H] COG2073 Cobalamin biosynthesis protein CbiG ... can be seen here [H] COG1010 Precorrin-3B methylase ... can be seen here [H] COG2099 Precorrin-6x reductase ... can be seen here [H] COG4822 Cobalamin biosynthesis protein CbiK, Co2+ chelatase ... can be seen here [H] COG2243 Precorrin-2 methylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................