                                                                        Gene putatively regulated by attenuation in P_putida_KT2440

This operon is putativelly rgulated by Riboflavin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:41 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:134 nt. Size=23 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:    Distance from promoter:109 nt.    Size=31 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-tatgct. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCACtggggtggcactgtgctgtatgctgggtcggtcttcagggcggggtgtaagtccccaccggcggtaaatcgaaagatgagcccgcgag
cgccccgaccatgtcgggggtcagcagatctggtgcaactccagagccgacggtcatagtccggatgaaagaaggcgtcatgcaggggccatccgggcgc
ccttgcgcgcgcattttgttcgccccgagacgttcatcgatcattcacgaggagcgtttcATG

    ribB Gene: ribB     GI: 26987268     BI number: PP0530     GOG: COG0108     Description: 3,4-dihydroxy-2-butanone 4-phosphate synthas                       c                     c  g                     t  g                     a  g   c                 c  c t  c                 cg g  g                 gc a  g                 gc ta         g        gc at       t  c       gt cg       a  a       at ta        cg        cg g  a       tg        gc g  a      g  g       tg c  g       cg       a  c a  a       gc       c  | g  a       gc        tg cg       a  a       gc cg        at        cg gc        gc        gc                         attttgttcgccccgagacgttcatcgatcattcacgaggagcgtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0108 3,4-dihydroxy-2-butanone 4-phosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Riboflavin_riboswitch sequence ... can be seen here     ..................................................................................................................