                                                                        Gene putatively regulated by attenuation in P_syringae

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taggctggcattacgaccgcgccccggcatagactggccgcgttcttgtcggggtgccttgctatgaggctgagatcggttaaaccggatcccgttgaac
ctgatcaggttagcgcctgcgtagggaacaagatttctcgtctcccggcgagtcctcttgagtgtcgtccggggtcgattgttcaaataatgaacagttt
cgccttctttcgatgctcagcaccagcactggtgcacccgtccgtcatgatcaggtcactccgacaataaatccgcaaccggatgtctggagagcccgtg
ATG

    thiC Gene: thiC     GI: 28872090     BI number: PSPTO4976     GOG: COG0422     Description: thiamin biosynthesis protein Thi            tt           c  g            ta            cg           c  t           t  g        t cc       g  |      a  a t  c       at       a  a cg        gc        at tg        cg        cg gc       |  t       ta cg        gc        ta ta        gc        gc cg        cg        ta t  t       cg        tg t  c       cg        at t  c       tg        gt at       |  t      |  t gc       |  c      c  c at        cg        tg at        ta        gc cg        gt        gc                         ttctttcgatgctcagcaccagcactggtgcacccgtccgtcatgatcaggtcactccgacaataaatccgcaaccggatgtctggagagcccgtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................