                                                                        Gene putatively regulated by attenuation in R_solanacearum

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=29 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttttccgctgcccggggacaactgccgacgttacgctttcctcgtttctttgcacaattgatgtacctgcgccgctcggcgcatgacattcgcctggccc
atcggccagctccggcgggtcttttcggtaattctgatagtttgcttaaggtaatttgcctgagctgggggaaatggccgggtttcgccgccttcatcct
gtcaactaatacgaaagacctatgtagaaaaaatcgaattgaccgactttcccgcttgtgcggtgcggcggatattctgcatgccacgctgtttttttat
TTG

    RSc1894 Gene: RSc1894     GI: 17546613     BI number: RS03456     GOG: COG0840     Description: PROBABLE METHYL-ACCEPTING CHEMOTAXIS TRANSDUCER TRANSMEMBRANE PROTEI             t           t  c tg       a  t t  t      t  g cg       a  c gc       g  a cg        gt cg        cg c  t       gc t  g       gc t  c      c  a tg        gc cg        tg a  |       gc gc        gt cg        cg cg        gt             ttttttatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in R_solanacearum This operon is putativelly rgulated by Guanine_G-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-13.50 kcal/mol Antiterminator: Size=47 nt.     Delta G=-16.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttttccgctgcccggggacaactgccgacgttacgctttcctcgtttctttgcacaattgatgtacctgcgccgctcggcgcatgacattcgcctggccc atcggccagctccggcgggtcttttcggtaattctgatagtttgcttaaggtaatttgcctgagctgggggaaatggccgggtttcgccgccttcatcct gtcaactaatacgaaagacctatgtagaaaaaatcgaattgaccgactttcccgcttgtgcggtgcggcggatattctgcatgccacgctgtttttttat TTG     RSc1894 Gene: RSc1894     GI: 17546613     BI number: RS03456     GOG: COG0840     Description: PROBABLE METHYL-ACCEPTING CHEMOTAXIS TRANSDUCER TRANSMEMBRANE PROTEI ct g  c cg cg gc cg gc ta        at c  t      c  c c  g       cg a  |       cg ta        gc gc        gc ta        ta |  t      |  g at       |  c gc       |  t tg       |  c t  c      |  c a  c       cg at        cg cg        gc a  |       cg cg        tg gc        tg             tcttttcggtaattctgatagtttgcttaaggtaatttgcctgagctgggggaaatggccgggtttcgccgccttcatcctgtcaactaatacgaaagacctatgtagaaaaaatcgaattgaccgactttcccgcttgtgcggtgcggcggatattctgcatgccacgctgtttttttatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................