                                                                        Gene putatively regulated by attenuation in S_oneidensis

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-17.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ccgcaaggcgtggactgttactggacgagcctctggagagactaccgattgcattaacttgcaataataggtggcgccgaaggcgaaagtgtcgctgtgt
tgttaagcgacgcgaaacgctcaggcaaaaggacagaggagaggatgactgcacagtctctgtcgtttgtctttgtgggctattttcctgccgttattgg
ctggggagatggtatttctttaggctgacagcgttgtgtcacagccatttcttttcctcctcccttattaatttaagttgtttaataattgaggaatatc
ATG

    SO0858 Gene: SO0858     GI: 24372447     BI number: SO0858     GOG: COG1115     Description: sodium:alanine symporter family protei             t           g  a           g  t           t  t ta        at t  t       gc gt        at cg        gt cg        gt gc       g  a       gt |  t      g  |      c  t tg        tg       g  g cg        cg        at cg        gc        cg tg        gt        at ta        tg        gc tg        ta       |  a ta       a  c      |  c at        ta        ta tg        tg        cg cg        gc        gc gt        cg        gc                         atttcttttcctcctcccttattaatttaagttgtttaataattgaggaatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in S_oneidensis This operon is putativelly rgulated by Glycine_cleavage                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:80 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-17.50 kcal/mol                                                                         Nomenclature/Definitions ccgcaaggcgtggactgttactggacgagcctctggagagactaccgattgcattaacttgcaataataggtggcgccgaaggcgaaagtgtcgctgtgt tgttaagcgacgcgaaacgctcaggcaaaaggacagaggagaggatgactgcacagtctctgtcgtttgtctttgtgggctattttcctgccgttattgg ctggggagatggtatttctttaggctgacagcgttgtgtcacagccatttcttttcctcctcccttattaatttaagttgtttaataattgaggaatatc ATG     SO0858 Gene: SO0858     GI: 24372447     BI number: SO0858     GOG: COG1115     Description: sodium:alanine symporter family protei           ta          t  t           gt           cg           cg           gc          |  t           tg           cg           cg           tg           ta           tg           ta           at           tg           cg           gt             atttctttaggctgacagcgttgtgtcacagccatttcttttcctcctcccttattaatttaagttgtttaataattgaggaatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................