                                                                        Gene putatively regulated by attenuation in S_oneidensis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-12.10 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=42 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:    Distance from promoter:43 nt.    Size=41 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tagttt. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagccacgccctcgccctttagttttagaccctatgaaaacaaataccctagcgttttttactttcttttttacacccccactctaggaggcggat
ttactgtgtaaaaacgaaagtaaaaatccaaagcctcccactgggaggctttttcgtcttaaacgcttgagaatccggcgataaatgaggtcagaATG

    pheA Gene: pheA     GI: 24372945     BI number: SO1367     GOG: COG0077,COG1605,COG2876     Description: chorismate mutase/prephenate dehydratas tc c  t a  a       aa cg       a  a cg        ta |  a       gc cg        tg cg       |  a |  c      g  a |  g       ta |  g       cg |  a       at |  t       ta |  t      |  a |  t      |  a |  a       ta |  c       ta |  t       at         c cg        gc       a  t at        gc        cg cg       |  a       cg at       |  a       cg ta       |  a       ta ta        cg        cg ta        gc        cg ta        gc        gc                         tttttcgtcttaaacgcttgagaatccggcgataaatgaggtcagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here     ..................................................................................................................