                                                                        Gene putatively regulated by attenuation in S_meliloti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.17 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctgccggagcgcgaggcgcaattgcatgaccgggcggaccgcctcgaagtgtcgcgcgtgctcgatccttgacttttcttccggtttcctgtttatcgcg
acgaattccttcgcaagtgatgacttccgaagccaccgaccgggccccgcaaaggtataaagagagcccggaggtcaacacccgacagcgcgttgcgccc
tcgggtggtttttggctttgcgccttgttttccgcgcgaagggacccacgtttccggacgagccgacctatcgcaatccggagacaagaaggaagagaat
ATG

    ffh --- pheAa --- rpsP Gene: ffh     GI: 15966993     BI number: SMc03857     GOG: COG0541     Description: PROBABLE SIGNAL RECOGNITION PARTICLE PROTEIN (FIFTY-FOUR HOMOLOG) Gene: pheAa     GI: 15966994     BI number: SMc03858     GOG: COG1605     Description: PUTATIVE CHORISMATE MUTASE PROTEIN Gene: rpsP     GI: 15966995     BI number: SMc03859     GOG: COG0228     Description: PROBABLE 30S RIBOSOMAL PROTEIN S1            gg           c  a   a        cg c  a       cg g  a       gt cg       a  c cg       g  a |  t      a  a |  a      g  c        t |  t      a  a      g  t |  a      a  c       cg |  a      a  c       gc |  a      t  c       cg |  g      a  g       gc |  a       ta       a  c |  g       gc       c  c c  a      g  a       at cg       a  g       gc gc       a  c       cg gc       a  |       cg gc        cg        cg cg        gc        at cg        cg        cg                         gtttttggctttgcgccttgttttccgcgcgaagggacccacgtttccggacgagccgacctatcgcaatccggagacaagaaggaagagaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0541 Signal recognition particle GTPase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here [J] COG0228 Ribosomal protein S16 ... can be seen here     ..................................................................................................................