Gene putatively regulated by attenuation in S_aureus_MW2

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:204 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:178 nt. Size=37 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:    Distance from promoter:142 nt.    Size=56 nt.     Delta G= -6.46 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTAT-TATAAT. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTATTGCTCGCGGAATTTAAGATATAATGAAATCGCATTCAAGAAATTTGATAGTC
ATTTGCTATCAATTTCAGAAATATATTATGAATTGCTAAATTTAATAAAAGCGAGTGA
TCAGTATTAGagagaatagagcgttaagactctatcgccgaaggtgcaagtaatttattacgaaactctcaggcaaaaggataatactgtaac
gcgttcctgaattggtgatttataaacagggtagcgattgctatcctgtttttataattttaagggggtatttcaATG

    MW1489 --- MW1488 --- MW1487


Gene: MW1489     GI: 21283218     BI number: MW1489     GOG: COG0404     Description: aminomethyltransferase
Gene: MW1488     GI: 21283217     BI number: MW1488     GOG: COG0403     Description: glycine dehydrogenase subunit 1
Gene: MW1487     GI: 21283216     BI number: MW1487     GOG: COG1003     Description:


 ta
a  c
 at
 tg
 at
|  a
g  a
g  c
a  g
a  c
a  g
a  t       ga
c  t      t  t
 gc        gt
 gc        gt
 at        ta
 cg       |  t
 ta       t  a
c  a      a  a       at
t  |      a  a      g  t
c  |       gc        cg
a  |       ta        gc
 at        cg        at
 at        cg        ta
g  g       tg        gt
 cg       t  t       gc
 at       g  a       gc
 tg        cg        at
 ta        gc        cg
 at        cg        at
                        ttttataattttaagggggtatttcaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0404 Glycine cleavage system T protein (aminomethyltransferase) ... can be seen here
[E] COG0403 Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain ... can be seen here
[E] COG1003 Glycine cleavage system protein P (pyridoxal-binding), C-terminal domain ... can be seen here

                                                                        Genes that have a predicted attenuator with a riboswitch:

Glycine_cleavage sequence ... can be seen here

    ..................................................................................................................